ID: 1040120581_1040120583

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1040120581 1040120583
Species Human (GRCh38) Human (GRCh38)
Location 8:43680552-43680574 8:43680568-43680590
Sequence CCTATGGTGAAACACCAAATATC AAATATCCCCAGATAGAAAATGG
Strand - +
Off-target summary {0: 2, 1: 39, 2: 511, 3: 11500, 4: 26589} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!