ID: 1040289748_1040289754

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1040289748 1040289754
Species Human (GRCh38) Human (GRCh38)
Location 8:46118170-46118192 8:46118219-46118241
Sequence CCTTCGGTGAGAGACACAGACAC GCCCACCTGAAACAGCCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 39, 3: 109, 4: 324} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!