ID: 1040332979_1040332993

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1040332979 1040332993
Species Human (GRCh38) Human (GRCh38)
Location 8:46401714-46401736 8:46401748-46401770
Sequence CCTGAGCCTCTAGCCCCCACCCA ACCATGGAGAATTCTGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!