ID: 1040332982_1040332996

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1040332982 1040332996
Species Human (GRCh38) Human (GRCh38)
Location 8:46401720-46401742 8:46401766-46401788
Sequence CCTCTAGCCCCCACCCAGAGGGG AAAGGAGAGGCCTCCCTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 356} {0: 1, 1: 0, 2: 3, 3: 22, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!