ID: 1040336839_1040336848

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1040336839 1040336848
Species Human (GRCh38) Human (GRCh38)
Location 8:46420383-46420405 8:46420434-46420456
Sequence CCGCAGACTTTGGAGCAGGGTGC GCAAAAACAAGGCTGCAGTGTGG
Strand - +
Off-target summary {0: 8, 1: 52, 2: 128, 3: 175, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!