ID: 1040360461_1040360467

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1040360461 1040360467
Species Human (GRCh38) Human (GRCh38)
Location 8:46659404-46659426 8:46659436-46659458
Sequence CCACCTGCTTGGGCCACCACTGC TGCTCAAGCAAGCCACCTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 18, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!