ID: 1040395096_1040395100

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1040395096 1040395100
Species Human (GRCh38) Human (GRCh38)
Location 8:46991158-46991180 8:46991187-46991209
Sequence CCCTTGTTTTTTCAAAGAAAGCA CCATTTCTTGCAGTCATACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 669} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!