ID: 1040491320_1040491334

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1040491320 1040491334
Species Human (GRCh38) Human (GRCh38)
Location 8:47924975-47924997 8:47925019-47925041
Sequence CCCTTCTCACCCTGCCTGCACCC CAACACGTGGGTGCCTCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 628} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!