ID: 1040506811_1040506815

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1040506811 1040506815
Species Human (GRCh38) Human (GRCh38)
Location 8:48056512-48056534 8:48056561-48056583
Sequence CCAAATAAAAAGCAAGAAATTAA CAAAAAAAGGAAAAGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 128, 4: 1416} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!