ID: 1040567340_1040567347

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1040567340 1040567347
Species Human (GRCh38) Human (GRCh38)
Location 8:48579551-48579573 8:48579579-48579601
Sequence CCTAAAATCTAAAGTTGGCCCTA TACTCCATTGGGGGAGAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!