ID: 1040604652_1040604657

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1040604652 1040604657
Species Human (GRCh38) Human (GRCh38)
Location 8:48919949-48919971 8:48919981-48920003
Sequence CCGCAGATCTTGCAAACACAAGG GGTCCGAATATGCATCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166} {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!