ID: 1040605122_1040605127

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1040605122 1040605127
Species Human (GRCh38) Human (GRCh38)
Location 8:48923938-48923960 8:48923972-48923994
Sequence CCAAGGATTCAGTCCTAGGTTGG TGCTCCATAATTAGGCTGATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!