ID: 1040621928_1040621942

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1040621928 1040621942
Species Human (GRCh38) Human (GRCh38)
Location 8:49101259-49101281 8:49101312-49101334
Sequence CCTCTGCCCCTCCAGGGAGGCCA GGTACCAAGATACCCCAAATTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 6, 3: 52, 4: 530} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!