ID: 1040641688_1040641691

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1040641688 1040641691
Species Human (GRCh38) Human (GRCh38)
Location 8:49341763-49341785 8:49341814-49341836
Sequence CCATGTTTTCTCTAGACCAGCTG AATTTTAAAGTTTCAATGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 49, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!