ID: 1040696662_1040696667

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1040696662 1040696667
Species Human (GRCh38) Human (GRCh38)
Location 8:50007641-50007663 8:50007679-50007701
Sequence CCTGAATGATAAGAGATTCCATA GTCACAGTGAGCTAAGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 175} {0: 1, 1: 0, 2: 1, 3: 26, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!