ID: 1040700948_1040700951

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1040700948 1040700951
Species Human (GRCh38) Human (GRCh38)
Location 8:50064760-50064782 8:50064789-50064811
Sequence CCTGGCTCCTTCTTATAATTCTG GCTCCCCTGCTAGCTTCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!