ID: 1040701815_1040701828

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1040701815 1040701828
Species Human (GRCh38) Human (GRCh38)
Location 8:50075137-50075159 8:50075166-50075188
Sequence CCTCTCCGCCTCCCCCCTGTGGG GGCAGCCGGAGCCTCCCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 434} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!