ID: 1040839633_1040839638

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1040839633 1040839638
Species Human (GRCh38) Human (GRCh38)
Location 8:51771540-51771562 8:51771575-51771597
Sequence CCTATCCTTGGGGGCAAGTAAGG GCAAGTATGTCACTTGCTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!