ID: 1040881795_1040881800

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1040881795 1040881800
Species Human (GRCh38) Human (GRCh38)
Location 8:52213388-52213410 8:52213421-52213443
Sequence CCTCCTAAAGGGCTGCAGGGTCA ACAGCTTTTCCTCTGTGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!