ID: 1040917249_1040917251

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1040917249 1040917251
Species Human (GRCh38) Human (GRCh38)
Location 8:52575104-52575126 8:52575117-52575139
Sequence CCTAAACTTTATCCAATATATGC CAATATATGCATAGTGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 251} {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!