ID: 1040959778_1040959787

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1040959778 1040959787
Species Human (GRCh38) Human (GRCh38)
Location 8:53019326-53019348 8:53019344-53019366
Sequence CCTGACACACCCTTCCTCACTGG ACTGGGTGGGGCTTCCCTGCAGG
Strand - +
Off-target summary No data {0: 12, 1: 60, 2: 120, 3: 177, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!