ID: 1040974869_1040974876

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1040974869 1040974876
Species Human (GRCh38) Human (GRCh38)
Location 8:53178792-53178814 8:53178825-53178847
Sequence CCACTGAAACAGAAGAGAAAGTG GTGCAGAGGCAGATAGAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!