ID: 1041062131_1041062148

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1041062131 1041062148
Species Human (GRCh38) Human (GRCh38)
Location 8:54044535-54044557 8:54044575-54044597
Sequence CCCAGACCAAAACAGGCAAGTTT CTGGGGGGTGACGGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!