ID: 1041108710_1041108714

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1041108710 1041108714
Species Human (GRCh38) Human (GRCh38)
Location 8:54466435-54466457 8:54466467-54466489
Sequence CCTGCGCGGGCGTCTGAGGCGCT CGGAGCGCGCTCCCCTCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55} {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
9 8:54466435-54466457 CCTGCGCGGGCGTCTGAGGCGCT - 8:54466467-54466489 CGGAGCGCGCTCCCCTCGCCAGG +