ID: 1041108855_1041108863

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1041108855 1041108863
Species Human (GRCh38) Human (GRCh38)
Location 8:54467146-54467168 8:54467161-54467183
Sequence CCACCTTCTTTTCCTCCGCGTCC CCGCGTCCGGCGGAGGGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 200, 4: 2142} {0: 1, 1: 0, 2: 1, 3: 1, 4: 28}
Status Too many individual off targets

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!