ID: 1041177210_1041177215

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1041177210 1041177215
Species Human (GRCh38) Human (GRCh38)
Location 8:55209138-55209160 8:55209166-55209188
Sequence CCAGCTCTGACCTCACTCAATTC AATGAACGTGGCCCCAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!