ID: 1041201117_1041201126

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1041201117 1041201126
Species Human (GRCh38) Human (GRCh38)
Location 8:55452564-55452586 8:55452590-55452612
Sequence CCTCCGGTTCTCCCGCTGCACCG CCAGGGTCTTAATGTTTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 175} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!