ID: 1041201431_1041201436

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1041201431 1041201436
Species Human (GRCh38) Human (GRCh38)
Location 8:55454287-55454309 8:55454304-55454326
Sequence CCTGGAAGGCCGCATTGACCCCG ACCCCGATTATGAAGGGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61} {0: 1, 1: 0, 2: 1, 3: 2, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!