ID: 1041271161_1041271165

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1041271161 1041271165
Species Human (GRCh38) Human (GRCh38)
Location 8:56110891-56110913 8:56110909-56110931
Sequence CCTAGTGGGCTCCTGTTCTCCAG TCCAGGGCCCCTAATTTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!