ID: 1041309726_1041309733

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1041309726 1041309733
Species Human (GRCh38) Human (GRCh38)
Location 8:56503113-56503135 8:56503162-56503184
Sequence CCAGGACATGCTGATAACATTAG CAGGGAAAGGAGATGGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!