ID: 1041328467_1041328468

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1041328467 1041328468
Species Human (GRCh38) Human (GRCh38)
Location 8:56696202-56696224 8:56696215-56696237
Sequence CCATTTGTGCTTCACCTCTCTAT ACCTCTCTATACTCTTGCCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!