ID: 1041373479_1041373491

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1041373479 1041373491
Species Human (GRCh38) Human (GRCh38)
Location 8:57189330-57189352 8:57189370-57189392
Sequence CCACGAAACTGGTCCCTGGTGCC GTGGTATAGCTAGGAAACAGTGG
Strand - +
Off-target summary {0: 85, 1: 651, 2: 1117, 3: 1570, 4: 1330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!