ID: 1041384090_1041384094

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1041384090 1041384094
Species Human (GRCh38) Human (GRCh38)
Location 8:57280174-57280196 8:57280188-57280210
Sequence CCCTGAGACAGCTGGGACCGCGC GGACCGCGCGCTCGGCTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!