ID: 1041483121_1041483130

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1041483121 1041483130
Species Human (GRCh38) Human (GRCh38)
Location 8:58345110-58345132 8:58345150-58345172
Sequence CCAACGTTTTTAGCACCAGGGAC AATTTTCCACAGATGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 75, 2: 1193, 3: 1819, 4: 1383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!