ID: 1041488341_1041488346

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1041488341 1041488346
Species Human (GRCh38) Human (GRCh38)
Location 8:58404032-58404054 8:58404059-58404081
Sequence CCCCCAAGGGTAGTGCTGAAGTA CTGGTGTTCCTAAGTACAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!