ID: 1041506410_1041506415

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1041506410 1041506415
Species Human (GRCh38) Human (GRCh38)
Location 8:58603332-58603354 8:58603370-58603392
Sequence CCACGCTGCCACTGCAGCATGTA CTCCGCCACATGGTGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 128} {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!