ID: 1041523463_1041523464

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1041523463 1041523464
Species Human (GRCh38) Human (GRCh38)
Location 8:58779736-58779758 8:58779752-58779774
Sequence CCTACTTCTCTTCATCTCCACCT TCCACCTCCTTCATGCCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 37, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!