ID: 1041723609_1041723626

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1041723609 1041723626
Species Human (GRCh38) Human (GRCh38)
Location 8:60998397-60998419 8:60998438-60998460
Sequence CCCGACTTAAGTTTCATATGAAG GGGGTAAGGGGTGAGGGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 37, 3: 334, 4: 2490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!