ID: 1041782029_1041782033

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1041782029 1041782033
Species Human (GRCh38) Human (GRCh38)
Location 8:61587262-61587284 8:61587315-61587337
Sequence CCATTATATGTTACCATATATGC TGACACAGATTGATGGTAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!