ID: 1041823128_1041823132

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1041823128 1041823132
Species Human (GRCh38) Human (GRCh38)
Location 8:62062541-62062563 8:62062579-62062601
Sequence CCCTAGATCTCAGAGGTGGAGCA CCACCAATCATCCCCCTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!