ID: 1041823813_1041823815

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1041823813 1041823815
Species Human (GRCh38) Human (GRCh38)
Location 8:62068680-62068702 8:62068693-62068715
Sequence CCATGGGAGTCCATCTCTTGCAT TCTCTTGCATCAGCATGACCTGG
Strand - +
Off-target summary {0: 2, 1: 53, 2: 492, 3: 1411, 4: 1724} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!