ID: 1041894511_1041894520

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1041894511 1041894520
Species Human (GRCh38) Human (GRCh38)
Location 8:62908048-62908070 8:62908095-62908117
Sequence CCTGCAAAGCCACAGCTGTGTAG TCCCTTGCATCAGTGTGACCCGG
Strand - +
Off-target summary No data {0: 2, 1: 65, 2: 575, 3: 1202, 4: 1795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!