ID: 1041923511_1041923516

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1041923511 1041923516
Species Human (GRCh38) Human (GRCh38)
Location 8:63210964-63210986 8:63210995-63211017
Sequence CCCATGTATTACTGTTCCAAAAG TATGTAGAAAGATACATTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145} {0: 1, 1: 0, 2: 0, 3: 34, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!