ID: 1042046490_1042046496

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1042046490 1042046496
Species Human (GRCh38) Human (GRCh38)
Location 8:64658141-64658163 8:64658184-64658206
Sequence CCTAACATCATTACCTTATAGAT TTAGGGGGAACACAAACATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 24, 3: 105, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!