ID: 1042059978_1042059979

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1042059978 1042059979
Species Human (GRCh38) Human (GRCh38)
Location 8:64806037-64806059 8:64806053-64806075
Sequence CCTCTCTGCTTCTGAGAACACAG AACACAGCAGTCACATTACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 92, 3: 1357, 4: 9130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!