ID: 1042156247_1042156250

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1042156247 1042156250
Species Human (GRCh38) Human (GRCh38)
Location 8:65847306-65847328 8:65847340-65847362
Sequence CCAAGCTCACAAGTGGAGAGGGC GATATCTGCTGTGGAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!