ID: 1042211873_1042211879

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1042211873 1042211879
Species Human (GRCh38) Human (GRCh38)
Location 8:66389395-66389417 8:66389422-66389444
Sequence CCTGGTCTCCACTTCCAAGTTGG TTGTTGCTGTATCCTCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 15, 3: 83, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!