ID: 1042226106_1042226111

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1042226106 1042226111
Species Human (GRCh38) Human (GRCh38)
Location 8:66515625-66515647 8:66515664-66515686
Sequence CCAGACCCAGAGCAGGGGGACAG CCCATGAACCAGTGTGTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 359} {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!