ID: 1042238077_1042238084

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1042238077 1042238084
Species Human (GRCh38) Human (GRCh38)
Location 8:66635718-66635740 8:66635755-66635777
Sequence CCTGGCCAACGTGGTGAAACCCC TACACAAAATTAGCTGGGCATGG
Strand - +
Off-target summary {0: 3177, 1: 73324, 2: 158390, 3: 197727, 4: 156676} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!