ID: 1042241279_1042241295

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1042241279 1042241295
Species Human (GRCh38) Human (GRCh38)
Location 8:66666877-66666899 8:66666924-66666946
Sequence CCAAGGACGACGGAGTCTGTGGA GGCAACGGAGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 2, 2: 117, 3: 1516, 4: 2959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!